View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5835-2 (Length: 229)
Name: Solexa-NF5835-2
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5835-2 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 3e-49; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 107 - 229
Target Start/End: Complemental strand, 30723718 - 30723596
Alignment:
| Q |
107 |
atttaggcttccaaaactacaagtataataagaactgcagggaggaactttgataaaaccacaatgcatctcaagcaccaattcttctaacatataagag |
206 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||| |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
30723718 |
atttaggcttccaaaactacaagtatcataagaactgcagggaggaactttgatagaacaacaacgcatctcaagaaccaattcttctaacttataagag |
30723619 |
T |
|
| Q |
207 |
taattaaaaagaatatgtgatgt |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30723618 |
taattaaaaagaatatgtgatgt |
30723596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 3 - 95
Target Start/End: Complemental strand, 35850865 - 35850773
Alignment:
| Q |
3 |
tcgagtgaaatgaatgtggaagatcaagaggaatcacaagatgtgatggacgatgattctagggattcctgttctgatgctgagacgccggtt |
95 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35850865 |
tcgagtgaattgaatgtggaagatcaagaggaatcacaagatgtgatggacgatgattctagggattcctgttctgatgctgagacgccggtt |
35850773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 13 - 87
Target Start/End: Complemental strand, 35841238 - 35841164
Alignment:
| Q |
13 |
tgaatgtggaagatcaagaggaatcacaagatgtgatggacgatgattctagggattcctgttctgatgctgaga |
87 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||| |||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
35841238 |
tgaatgcggaagatcaagaggattcacgagatgttatggacgatgattctagggatttgtgttcggatgctgaga |
35841164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University