View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5835-22 (Length: 101)
Name: Solexa-NF5835-22
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5835-22 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 4136741 - 4136841
Alignment:
| Q |
1 |
acttacgattgaatgagactcatgagttcatcttccccataagagctaacagaaagtttagtactcactcgttgtaataagttcccaccagcatcaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || | ||||| ||||||||||||| |
|
|
| T |
4136741 |
acttacgattgaatgagactcatgagttcatcttccccataagagctaacagaaagcttagtactcactcgttgcaacagattcccgccagcatcaaatt |
4136840 |
T |
|
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
4136841 |
g |
4136841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University