View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5835-26 (Length: 77)
Name: Solexa-NF5835-26
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5835-26 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 1e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 26353389 - 26353440
Alignment:
| Q |
27 |
taaaactagtattacttattccttcaattgttttcaacacaat-aagagtat |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26353389 |
taaaactagtattacttattccttcaattgttttcaacacaatcaagagtat |
26353440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 26353428 - 26353393
Alignment:
| Q |
1 |
gtgttgaaaacaattgaaggaataagtaaaactagt |
36 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26353428 |
gtgttgaaaacaattgaaggaataagtaatactagt |
26353393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University