View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5835-3 (Length: 217)
Name: Solexa-NF5835-3
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5835-3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 10 - 157
Target Start/End: Complemental strand, 10677128 - 10676981
Alignment:
| Q |
10 |
gtagaagcttaagctttttcccgtggccagatgtttttgggtgagttccttttagcttagagataccaccctttgggtagtcaagctcgtgtgtgaaaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10677128 |
gtagaagcttaagctttttcccgtggccagatgtttttggatgagttccttttagcttagagataccaccctttgggtagttaagctcgtgtgtgaaaac |
10677029 |
T |
|
| Q |
110 |
aacttattaatttaatttatcttgtgttagtttccccatttgaatgca |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10677028 |
aacttattaatttaatttatcttgtgttagtttccccattggaatgca |
10676981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University