View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5835-30 (Length: 50)
Name: Solexa-NF5835-30
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5835-30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.00000000000001; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 1432875 - 1432918
Alignment:
| Q |
1 |
gatctttcaaatttgtagtacttgtaagctgtgactcagatatg |
44 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1432875 |
gatctttcaaatttgcagtacttgtaagctgtgactcagatatg |
1432918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.0000000008
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 1445396 - 1445439
Alignment:
| Q |
7 |
tcaaatttgtagtacttgtaagctgtgactcagatatgatattg |
50 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
1445396 |
tcaaatttggagtacttgtaagttgtgaatcagatatgatattg |
1445439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.0000000008
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 1451572 - 1451615
Alignment:
| Q |
7 |
tcaaatttgtagtacttgtaagctgtgactcagatatgatattg |
50 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
1451572 |
tcaaatttgcagtacttgtaagttgtgaatcagatatgatattg |
1451615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University