View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5835-30 (Length: 50)

Name: Solexa-NF5835-30
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5835-30
Solexa-NF5835-30
[»] chr2 (3 HSPs)
chr2 (1-44)||(1432875-1432918)
chr2 (7-50)||(1445396-1445439)
chr2 (7-50)||(1451572-1451615)


Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.00000000000001; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 1432875 - 1432918
Alignment:
1 gatctttcaaatttgtagtacttgtaagctgtgactcagatatg 44  Q
    ||||||||||||||| ||||||||||||||||||||||||||||    
1432875 gatctttcaaatttgcagtacttgtaagctgtgactcagatatg 1432918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.0000000008
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 1445396 - 1445439
Alignment:
7 tcaaatttgtagtacttgtaagctgtgactcagatatgatattg 50  Q
    ||||||||| |||||||||||| ||||| |||||||||||||||    
1445396 tcaaatttggagtacttgtaagttgtgaatcagatatgatattg 1445439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.0000000008
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 1451572 - 1451615
Alignment:
7 tcaaatttgtagtacttgtaagctgtgactcagatatgatattg 50  Q
    ||||||||| |||||||||||| ||||| |||||||||||||||    
1451572 tcaaatttgcagtacttgtaagttgtgaatcagatatgatattg 1451615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University