View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-11 (Length: 145)
Name: Solexa-NF5836-11
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-11 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 9e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 9e-62
Query Start/End: Original strand, 7 - 145
Target Start/End: Complemental strand, 2229676 - 2229537
Alignment:
| Q |
7 |
agaactggtgagcttgtttggttgacccatttggataatcatcctgcaggagttattaccatgtctggaacttattataatgggttagtataattac-tt |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
2229676 |
agaactggtgagcttatttggttgacccatttggataatcatcctgcaggagttattaccatgtctggaacttattataatgggttagtataattccatt |
2229577 |
T |
|
| Q |
106 |
ctcttgatcttctttctaatattttaaaaatcaaatttag |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2229576 |
ctcttgatcttctttctaatattttaaaaatcagatttag |
2229537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 3e-34
Query Start/End: Original strand, 7 - 96
Target Start/End: Complemental strand, 2238637 - 2238548
Alignment:
| Q |
7 |
agaactggtgagcttgtttggttgacccatttggataatcatcctgcaggagttattaccatgtctggaacttattataatgggttagta |
96 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
2238637 |
agaactggtgagcttgtttggttgactcatttggataatcaccctgcaggagttgttaccatgtctggaacttattacaatgggttagta |
2238548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University