View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5836-13 (Length: 142)

Name: Solexa-NF5836-13
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5836-13
Solexa-NF5836-13
[»] chr1 (1 HSPs)
chr1 (7-104)||(46736626-46736723)
[»] chr6 (1 HSPs)
chr6 (100-142)||(32377484-32377526)


Alignment Details
Target: chr1 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 7 - 104
Target Start/End: Complemental strand, 46736723 - 46736626
Alignment:
7 ttacttaatgtacataataatactcattaaaaattgagtatgactattatgggccacgagcaggtttaaaacaaaaacgaaatggagtctgggcttct 104  Q
    |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||    
46736723 ttacttaatgtacataattatactcattaaaaattgagtatgattattatgggccacgagcaggtttaaaacaaaaacaaaatggagtctggtcttct 46736626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 100 - 142
Target Start/End: Original strand, 32377484 - 32377526
Alignment:
100 cttcttgtggattttggggtgtcttttttcttttgattacgat 142  Q
    |||||| |||||||||  |||||||||||||||||||||||||    
32377484 cttcttttggattttgttgtgtcttttttcttttgattacgat 32377526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University