View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-13 (Length: 142)
Name: Solexa-NF5836-13
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-13 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 7 - 104
Target Start/End: Complemental strand, 46736723 - 46736626
Alignment:
| Q |
7 |
ttacttaatgtacataataatactcattaaaaattgagtatgactattatgggccacgagcaggtttaaaacaaaaacgaaatggagtctgggcttct |
104 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
46736723 |
ttacttaatgtacataattatactcattaaaaattgagtatgattattatgggccacgagcaggtttaaaacaaaaacaaaatggagtctggtcttct |
46736626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 100 - 142
Target Start/End: Original strand, 32377484 - 32377526
Alignment:
| Q |
100 |
cttcttgtggattttggggtgtcttttttcttttgattacgat |
142 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32377484 |
cttcttttggattttgttgtgtcttttttcttttgattacgat |
32377526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University