View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-15 (Length: 139)
Name: Solexa-NF5836-15
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 6e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 6e-63
Query Start/End: Original strand, 5 - 134
Target Start/End: Original strand, 48449858 - 48449987
Alignment:
| Q |
5 |
atgaataaaaatgagaaggatgtaaatattgaggaaaacatggtggaaactagtaatgaagagagagtaaatagagctaattggatagagaggcttgtgg |
104 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48449858 |
atgaataaaagggagaaggatgtaaatattgaggaaaacatggtggaaactagtaatgaagagagagtaaatagagctaattggatagagaggcttgtgg |
48449957 |
T |
|
| Q |
105 |
aaattaagaaacattggagaaacaggttac |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48449958 |
aaattaagaaacattggagaaacaggttac |
48449987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University