View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-2 (Length: 252)
Name: Solexa-NF5836-2
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 46736723 - 46736481
Alignment:
| Q |
8 |
ttacttaatgtacataataatactcattaaaaattgagtatgactattatgggccacgagcaggtttaaaacaaaaacaaaatggagtctggtcttctct |
107 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46736723 |
ttacttaatgtacataattatactcattaaaaattgagtatgattattatgggccacgagcaggtttaaaacaaaaacaaaatggagtctggtcttctct |
46736624 |
T |
|
| Q |
108 |
tatcattccgcctcctttgcttgtatcaatttcttccaacattgtcaccacatctttcatttccggacgcttttctggattcttgtcccagcatcttttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46736623 |
tatcattccgcctcctttgcttgtatcaattttttccaacattgtcaccacatctttcatttccggacgcttttctggattcttgtcccagcatcttttc |
46736524 |
T |
|
| Q |
208 |
attatacctgctaatgcacttggacagcatctaggaatctctg |
250 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46736523 |
attatatctgctaatgcacttggacagcatctaggaatctctg |
46736481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 176
Target Start/End: Complemental strand, 986262 - 986195
Alignment:
| Q |
109 |
atcattccgcctcctttgcttgtatcaatttcttccaacattgtcaccacatctttcatttccggacg |
176 |
Q |
| |
|
|||||||| || |||||||||||||| | | |||| | |||| |||||||||| |||||||||||||| |
|
|
| T |
986262 |
atcattccaccacctttgcttgtatccagtgcttctagcattatcaccacatccttcatttccggacg |
986195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University