View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-22 (Length: 127)
Name: Solexa-NF5836-22
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 7e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 7e-50
Query Start/End: Original strand, 7 - 110
Target Start/End: Complemental strand, 24413271 - 24413168
Alignment:
| Q |
7 |
aataagttgtagactacctgcatcatctacatctattgattctaatgattaaaatatcttgtcatatgactaaaccagaacttgaacaaccgccaaatga |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24413271 |
aataagttctagactacctgcatcatctacatctattgattctaatgattaaaatatcttgtcatatgactaaaccagaacttgaacaaccgccaaatga |
24413172 |
T |
|
| Q |
107 |
agcc |
110 |
Q |
| |
|
|||| |
|
|
| T |
24413171 |
agcc |
24413168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University