View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-24 (Length: 121)
Name: Solexa-NF5836-24
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-24 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 2e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 39454257 - 39454130
Alignment:
| Q |
1 |
gagatgatactaagctaaccataataagctccatgttgaaaggcaagttgatcatcct-------tctatgaaaattccattgatcactagttgcggaag |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39454257 |
gagatgatactaagctaaccataataagctccatgttgaaaggcaagttgatcatccttctaagttctatgaaaattccattgatcactagttgcggaag |
39454158 |
T |
|
| Q |
94 |
gaagtgtcgctggaatatttgtacatta |
121 |
Q |
| |
|
|||||||||||||| |||||||||||| |
|
|
| T |
39454157 |
gaagtgtcgctggataatttgtacatta |
39454130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 34 - 81
Target Start/End: Original strand, 39451281 - 39451328
Alignment:
| Q |
34 |
tgttgaaaggcaagttgatcatccttctatgaaaattccattgatcac |
81 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39451281 |
tgttgaaagccaagttgaaaatccttctatgaaaattccattgatcac |
39451328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University