View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-25 (Length: 115)
Name: Solexa-NF5836-25
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-25 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 46736205 - 46736319
Alignment:
| Q |
1 |
cataggcttagtcatttattagttcctatatatcacacagtaaactcttcaggctgtcatcatatgaccataaatattaagtatttttaactaaatttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46736205 |
cataggcttagtcatttattagttcctatatatcacacagtaaactctttaggctttcatcatatgaccataaatattaagtatttttaactaaatttac |
46736304 |
T |
|
| Q |
101 |
tcttattaagtatca |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46736305 |
tcttattaagtatca |
46736319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University