View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-27 (Length: 96)
Name: Solexa-NF5836-27
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-27 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 1e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 3343748 - 3343660
Alignment:
| Q |
8 |
ctttcatggttcgtagaggcaacctggagtagaaatggacacaaaccatccattgatgcttacttaaaaacaggcatgacctcaattgg |
96 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3343748 |
ctttcatggttcatagaggcaacctggagtagaaatggacacaaaccatccattgatgcttacttaaaaacaggcatgacttcaattgg |
3343660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 3368604 - 3368525
Alignment:
| Q |
8 |
ctttcatggttcgtagaggcaacctggagtagaaatggacacaaaccatccattgatgcttacttaaaaacaggcatgac |
87 |
Q |
| |
|
||||||||| || ||||||||| ||||| ||||||||||||||||||||| ||||| |||| | |||||||||||||| |
|
|
| T |
3368604 |
ctttcatggctcatagaggcaaaatggagcagaaatggacacaaaccatcccttgattgttacctcaaaacaggcatgac |
3368525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University