View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-31 (Length: 51)
Name: Solexa-NF5836-31
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-31 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] scaffold0405 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 6e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 9695311 - 9695268
Alignment:
| Q |
8 |
caacggacttgttgcttggattctccttcttgaacctctctctg |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9695311 |
caacggacttgttgcttggattctccttcttgaacctctctctg |
9695268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0405 (Bit Score: 32; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0405
Description:
Target: scaffold0405; HSP #1
Raw Score: 32; E-Value: 0.0000000008
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 15196 - 15239
Alignment:
| Q |
7 |
acaacggacttgttgcttggattctccttcttgaacctctctct |
50 |
Q |
| |
|
|||||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
15196 |
acaacggatttgttgcttgaattctctttcttgaacctctctct |
15239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University