View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-4 (Length: 215)
Name: Solexa-NF5836-4
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 215
Target Start/End: Original strand, 53557838 - 53558046
Alignment:
| Q |
7 |
acacaaatggaatagatgagaattcttattcaaattcattaagtagctcagctcttgagagacttcaacttcatatgcaacttcaaagccttcaaaaccc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53557838 |
acacaaatggaatagatgagaattcttattcaaattcattaagtagctcagctcttgagagacttcaacttcatatgcaacttcaaagccttcaaaaccc |
53557937 |
T |
 |
| Q |
107 |
tttgtctttttacagtaataaccctgctgcactagtttggccaaagttgcatccttctcaagaaaaaatgatccaaattagccttcaaaactctaataac |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53557938 |
tttgtctttttacaataataaccctgctgcactagtttggccaaagttgcatccttctcaagaaaaaatgatccaaattagccttcaaaactctaataac |
53558037 |
T |
 |
| Q |
207 |
aaccctatg |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
53558038 |
aaccctatg |
53558046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University