View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-5 (Length: 199)
Name: Solexa-NF5836-5
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 186
Target Start/End: Complemental strand, 48450677 - 48450499
Alignment:
| Q |
8 |
ccttctgcttcctgttccggagaatcctttcttccactagaatcttcatttttactctgttgtgacttagcagcaagggtcaaaaggttcttagctcgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48450677 |
ccttctgcttcctgttccggagaatcctttcttccactagaatcttcatttttactctgttgtgacttagcagcaagggtcaaaaggttcttagctcgca |
48450578 |
T |
 |
| Q |
108 |
gttgaacataggaggcagctgaggcagcaatgtcataagctagtcgaatttgaggattctgttccttatcttttccttc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48450577 |
attgaacataggaggcagctgaggcagcaatgtcataagctagtcgaatttgaggattctgttccttatcttttccttc |
48450499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University