View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5836-6 (Length: 181)
Name: Solexa-NF5836-6
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5836-6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 6e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 6e-82
Query Start/End: Original strand, 7 - 168
Target Start/End: Complemental strand, 50671509 - 50671348
Alignment:
| Q |
7 |
aaagatggagtggtcctcatttcaacttgaaaaatgaaatcatttcaacaacgaaattgcatggaattggtaataaaatctggtacacaatctatgttgc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50671509 |
aaagatggagtggtcctcatttcaacttgaaaaatgaaatcatttcaacaacgaaattgcatggaattggtaataaaatctggtacacaatctatgttgc |
50671410 |
T |
 |
| Q |
107 |
acttcatcccaaatcaagacatgttttccctcgttaattagttgccattaacttttgctttc |
168 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50671409 |
acttcatcccaaatcaagaaatgttttccctcgttaattagttgctattaacttttgctttc |
50671348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University