View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5837-10 (Length: 127)
Name: Solexa-NF5837-10
Description: NF5837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5837-10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 25 - 127
Target Start/End: Complemental strand, 2708047 - 2707945
Alignment:
| Q |
25 |
tcatcatggattcgagttccatcattgtgtaatttctgagcaatgccgatactccaacactaataagtatatatgctattcaatcatacgaatgaaaata |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2708047 |
tcatcatggattcgagttccatcattgtgtaatttctgagcaatgccgatactccaacactaataagtatatatgctattcaatcatacgaatgaaaata |
2707948 |
T |
 |
| Q |
125 |
aca |
127 |
Q |
| |
|
||| |
|
|
| T |
2707947 |
aca |
2707945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University