View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5837-11 (Length: 127)
Name: Solexa-NF5837-11
Description: NF5837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5837-11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 2e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 5535991 - 5535911
Alignment:
| Q |
8 |
taattttccagaaacattaaaacatgtagtatggagaggtacgtagaaggtgaagataaaatgtcggagaaagatgcggta |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
5535991 |
taattttccagaaacattaaaacatgtagtatggagagttacgtagaagatgaagataaaatgtcggagaaggatgcggta |
5535911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University