View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5837-13 (Length: 127)
Name: Solexa-NF5837-13
Description: NF5837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5837-13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 3e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 2342952 - 2342826
Alignment:
| Q |
1 |
gagagatgaagaagatcaggctgaatttggatcaagtgcaggcccttgagaagagctttgaatttgggaacaagcttgatccagaaagaaaagtgcaact |
100 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2342952 |
gagagaagaagaagatcagactgaatttggatcaagtgcaggcccttgagaagagctttgaatttgggaacaagcttgatccagaaagaaaagtgcaact |
2342853 |
T |
|
| Q |
101 |
tgctaaggctttagggttgcagcctag |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2342852 |
tgctaaggctttagggttgcagcctag |
2342826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University