View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5837-2 (Length: 274)
Name: Solexa-NF5837-2
Description: NF5837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5837-2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 7 - 273
Target Start/End: Original strand, 29847711 - 29847977
Alignment:
| Q |
7 |
atgtgagtggatccctaacactaacacaaacacaaactcttcaaaaaacatcaccaccattggttacaagatgctccctgattggggctatggccatgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847711 |
atgtgagtggatccctaacactaacacaaacacaaactcttcaaaaaacatcaccaccattggttacaagatgctccctgattggggctatggccatgtt |
29847810 |
T |
 |
| Q |
107 |
tatactgttgtgattgttaactgcactttcaatgaatcaatcaatgttgataacaatggtggaaagttgatgctatatgcttctacatcaggtggtggtg |
206 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847811 |
tataccgttgtgattgttaactgcactttcaatgaatcaatcaatgttgataacagtggtggaaagttgatgctatatgcttctacatcaggtggtggtg |
29847910 |
T |
 |
| Q |
207 |
acacaaagtttaacattactgatagaatggaagttcttgttgaacaacctaaggttttggatattac |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847911 |
acacaaagtttaacattactgatagaatggaagttcttgttgaacaacctaaggttttggatattac |
29847977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 68 - 136
Target Start/End: Complemental strand, 14831107 - 14831039
Alignment:
| Q |
68 |
ggttacaagatgctccctgattggggctatggccatgtttatactgttgtgattgttaactgcactttc |
136 |
Q |
| |
|
||||||||||| |||||||| |||||||| |||| |||||| || || || || |||||||| |||||| |
|
|
| T |
14831107 |
ggttacaagatcctccctgactggggctacggccgtgtttacacggtcgtaatcgttaactgtactttc |
14831039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University