View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5837-3 (Length: 222)
Name: Solexa-NF5837-3
Description: NF5837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5837-3 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 222
Target Start/End: Original strand, 2341358 - 2341570
Alignment:
| Q |
10 |
aactgcaatgcaacaccattaggttaaaacataaaagtgtaacaaagtatatctacttacattaatttttaaactatatgatgatcgaaaccgtgttcga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2341358 |
aactgcaatgcaacaccattaggttaaaacataaaagtgtaacaaagtatatctagttacattaatttttaaactatatgatgattgaaaccgtgttcga |
2341457 |
T |
|
| Q |
110 |
gtctaacaccgatacattaggttacattctatcgatgcacaaacacggcaacatttataataatttggataaatgcaattgttgaatgtaactttatatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341458 |
gtctaacaccgatacattaggttacattctatcgatgcacaaacacggcaacatttataataatttggataaatgcaattgttgaatgtaactttatatg |
2341557 |
T |
|
| Q |
210 |
ttggtctagtgtt |
222 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
2341558 |
ttggtatagtgtt |
2341570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University