View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5837-6 (Length: 140)
Name: Solexa-NF5837-6
Description: NF5837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5837-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 2 - 140
Target Start/End: Original strand, 5535737 - 5535875
Alignment:
| Q |
2 |
ataggatgaaaaaagggttgtgtttagcctgggaaagcccaaactttcccaccatggtgcataacctgcacgtggcagttcaaccagttgtcaaataaaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5535737 |
ataggatgaaaaaagggttgtgtttagcctgggaaagcccaaactttcccaccatggtgcataacctgcacgtggcagttcaaccagttgtcaaataaaa |
5535836 |
T |
|
| Q |
102 |
taggannnnnnngtcaaccaatcaaactttgccatttgg |
140 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
5535837 |
taggatttttttgtcaaccaatcaaactttgccatttgg |
5535875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University