View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5838-12 (Length: 120)
Name: Solexa-NF5838-12
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5838-12 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 4e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 4082556 - 4082668
Alignment:
| Q |
8 |
tgaaaacactccctcatctcaacatgagggtcttcaagagtctggacaacagccattgaaatttgaaagtttcttccggctccggcttccgttggtttgt |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
4082556 |
tgaaaacgctccctcatctcaacatgagggtcttcaagagtctggacaacagccattgaaatttgaaagtttcttccgactccggcttccattggtttgt |
4082655 |
T |
|
| Q |
108 |
gtttgtgtctgtg |
120 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
4082656 |
gtttgtgtttgtg |
4082668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 10 - 115
Target Start/End: Original strand, 4092267 - 4092372
Alignment:
| Q |
10 |
aaaacactccctcatctcaacatgagggtcttcaagagtctggacaacagccattgaaatttgaaagtttcttccggctccggcttccgttggtttgtgt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4092267 |
aaaacgctccctcatctcaacatgagggtcttcaagagtctggacaacatccattgaaatttgaaagtttcttccggctccggcttccattggtttgtgt |
4092366 |
T |
|
| Q |
110 |
ttgtgt |
115 |
Q |
| |
|
|||||| |
|
|
| T |
4092367 |
ttgtgt |
4092372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University