View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5838-14 (Length: 115)
Name: Solexa-NF5838-14
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5838-14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 7 - 115
Target Start/End: Original strand, 43550111 - 43550219
Alignment:
| Q |
7 |
acgcttgcacttatgcggaggtggaaaagtcaaggtgttaatgtcctgaggaatgtgttaaccatgagtagtactggtgatgttcgaaaagtgtggaatc |
106 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
43550111 |
acgcttgcacttgtgcggaggtgcaaaagtcaaggtgtcaatgtcctgaggaatgtgttaaccatgagtagtactggtgattttcgaaaagtttggaatc |
43550210 |
T |
 |
| Q |
107 |
ttctagaat |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
43550211 |
ttctagaat |
43550219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University