View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5838-16 (Length: 95)
Name: Solexa-NF5838-16
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5838-16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 11 - 95
Target Start/End: Original strand, 39915355 - 39915439
Alignment:
| Q |
11 |
atgaaattcatttcagcaaattaccattaactctaagaactgatatcgagaacataaaaataaaatgttttttattggaaaaagt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
39915355 |
atgaaattcatttcagcaaattaccattaactctaagaactgatatcgagaatataaaaataaaatgttttttattgcaaaaagt |
39915439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University