View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5838-17 (Length: 91)
Name: Solexa-NF5838-17
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5838-17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 7 - 53
Target Start/End: Complemental strand, 9377044 - 9376998
Alignment:
| Q |
7 |
agagcacacttatactataactcaattgcgcaacatagagatgaaag |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9377044 |
agagcacacttatactataactcaattgcgcaacatagagatgaaag |
9376998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 37704367 - 37704408
Alignment:
| Q |
50 |
aaaggaccgcatcttgatgattcaggatataccaattgatta |
91 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
37704367 |
aaaggaccgcattttgatgatttaggatataccaattgatta |
37704408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University