View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5838-3 (Length: 187)
Name: Solexa-NF5838-3
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5838-3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 48 - 161
Target Start/End: Complemental strand, 31111481 - 31111368
Alignment:
| Q |
48 |
tgagatgaatgcatcgagggttttttgtgggttctagatttacatattatttcttcaaattttgggttgaagatgaatgttttgagggaagttgatgaaa |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31111481 |
tgagatgaatgcatcgagggttttttgtgggttctagatctacatattatttcttcaaatttttggttgaagatgaatgttttgagggaagttgatgaaa |
31111382 |
T |
|
| Q |
148 |
atatgtaatcttgg |
161 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31111381 |
atatgtaatcttgg |
31111368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 62 - 161
Target Start/End: Complemental strand, 31057492 - 31057393
Alignment:
| Q |
62 |
cgagggttttttgtgggttctagatttacatattatttcttcaaattttgggttgaagatgaatgttttgagggaagttgatgaaaatatgtaatcttgg |
161 |
Q |
| |
|
|||| ||||||| |||||||||||| || |||| ||||||||| || | ||||||| ||||||||| |||| ||||||||||| ||||||||| |||| |
|
|
| T |
31057492 |
cgagtgttttttatgggttctagatctatgtattctttcttcaatttataggttgaaaatgaatgttaagaggaaagttgatgaagatatgtaatgttgg |
31057393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University