View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5838-4 (Length: 175)
Name: Solexa-NF5838-4
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5838-4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 8 - 175
Target Start/End: Original strand, 3659915 - 3660094
Alignment:
| Q |
8 |
ttgttcccatcccttctagcgaccacaccatcagttactccatcgttatcataatca------------tgaacgctctcctcattctctaaaccttcct |
95 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3659915 |
ttgttcccatcccttctagcgaccacaacatcagttactccatcgtcatcataatcatcatcatcatcatgaacgctctcctcattctctaaaccttcct |
3660014 |
T |
 |
| Q |
96 |
catcatctccataaaccttacacaatttgctaatcttctcaactctccccctcaaattcttcaacagcttcttcttctca |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3660015 |
catcatctccataaaccttacacaatttgctaatcttctcaactctccccctcaaattcttcaacagcttcttcttctca |
3660094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University