View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5838-7 (Length: 141)
Name: Solexa-NF5838-7
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5838-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 4 - 141
Target Start/End: Original strand, 53285411 - 53285539
Alignment:
| Q |
4 |
agagttcactcatttgtaagattgtaagtttaattctttagtgaatgatttgtagataactcagtaaatatttagtcttcgaagcctaattcttttacct |
103 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53285411 |
agagttcactcatttgtaagattgtgagtttaattct---------gatttgtacataacgcagtaaatatttagtcttcgaagcctaattcttttacct |
53285501 |
T |
|
| Q |
104 |
ttttgtatcaaaacacaatgacccgttcttatgcgatg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53285502 |
ttttgtatcaaaacacaatgacccgttcttatgcgatg |
53285539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University