View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-1 (Length: 253)
Name: Solexa-NF5839-1
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 253
Target Start/End: Complemental strand, 28079634 - 28079388
Alignment:
| Q |
7 |
agatatcaagcaactctcatctacaactttcttgtttaacttcaacatgtgcagaacttatcaaaggatcaacaactttatatgatcatgtcaacgatcc |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28079634 |
agatatcaagcaactctcatctgcaacttttttgtttaatttcaacatgtgcagaacttatcaaaggatcaacaactttatatgatcatgtcaacgatcc |
28079535 |
T |
|
| Q |
107 |
tattggtgttgccaatgccatgtttagaaatggatgtgttttggtggtattctagtggtttaatattctggtttacgttgacggnnnnnnngttgttgta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28079534 |
tattggtgttgccaatgccatgtttagaaatggatgtgttttggtggtattctagtggtttaatattctggtttacgttgacggtttttttgttgttgta |
28079435 |
T |
|
| Q |
207 |
agtatctgttttgggggaaggatatataaggggaccatggttgtcat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28079434 |
agtatctgttttgggggaaggatatataaggggaccatggttgtcat |
28079388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University