View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-11 (Length: 143)
Name: Solexa-NF5839-11
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 27 - 143
Target Start/End: Original strand, 28079154 - 28079270
Alignment:
| Q |
27 |
gtctattaagtggatcttactattaaagacaagtggatataataggaaaatggaaagtaggaggaagcttggaagggaaatgagtactttatatcaaagg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28079154 |
gtctattaagtggatcttactattaaagacaagtggatataataggaaaatggaaagtaggaggaagcttggaagggaaatgagtactttgtatcaaagg |
28079253 |
T |
 |
| Q |
127 |
gaagaaaagtaatatga |
143 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28079254 |
gaagaaaagtaatatga |
28079270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University