View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-14 (Length: 140)
Name: Solexa-NF5839-14
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 3 - 140
Target Start/End: Complemental strand, 46415568 - 46415431
Alignment:
| Q |
3 |
aggcaccataaccttctggaattcagccatgccggtcatttccaaaacctcttccaactcactcatgaacattagctccttttggctattagtaactggc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46415568 |
aggcaccataaccttctggaattcagccatgctggtcatttccaaaacctcttccaactcactcatgaacattagctccttttggctattagtaactggc |
46415469 |
T |
 |
| Q |
103 |
caatacttcaatagtccctttatcactgagctaaccaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46415468 |
caatacttcaatagtccctttatcactgagctaaccaa |
46415431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University