View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-17 (Length: 138)
Name: Solexa-NF5839-17
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-17 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 174714 - 174851
Alignment:
| Q |
1 |
gaaacacgcataagttcatttatgaatcatattttttgcaaccatatttatcatgaaattgcattttagtcacaggttattatctctacttatatagaca |
100 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
174714 |
gaaacatgcacaagttcatttatgaatcatattttttgcaaccatatttatcatgaaattgcattttagtcacaggttattatctatacttatatataca |
174813 |
T |
 |
| Q |
101 |
ggggatacacacacgattttgtgatgatattttttctt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
174814 |
ggggatacacacacgattttgtgatgatactttttctt |
174851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University