View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-18 (Length: 136)
Name: Solexa-NF5839-18
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 2e-22; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 75 - 132
Target Start/End: Original strand, 36956064 - 36956121
Alignment:
| Q |
75 |
cctcacaattgtttcaacacttataatcacagcatcagtagcagcatgttttgctgtt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36956064 |
cctcacaattgtttcaacacttataatcacagcatcagtagcagcatgtttagctgtt |
36956121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 37069970 - 37069914
Alignment:
| Q |
76 |
ctcacaattgtttcaacacttataatcacagcatcagtagcagcatgttttgctgtt |
132 |
Q |
| |
|
|||||| | |||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
37069970 |
ctcacattggtttcaacacttataatcactgcttcagtagcagcatgttttgctgtt |
37069914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 85 - 132
Target Start/End: Original strand, 36947998 - 36948045
Alignment:
| Q |
85 |
gtttcaacacttataatcacagcatcagtagcagcatgttttgctgtt |
132 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36947998 |
gtttcaacccttataatcactgcatcagtagcagcatgttttgctgtt |
36948045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 85 - 132
Target Start/End: Original strand, 36971668 - 36971715
Alignment:
| Q |
85 |
gtttcaacacttataatcacagcatcagtagcagcatgttttgctgtt |
132 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
36971668 |
gtttcaacacttataatcactgcatcagtagcagcatgttttggtgtt |
36971715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 79 - 125
Target Start/End: Original strand, 36935214 - 36935260
Alignment:
| Q |
79 |
acaattgtttcaacacttataatcacagcatcagtagcagcatgttt |
125 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
36935214 |
acaattgtttcaacacttataatcactgcttcagtagcagcatgttt |
36935260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 37079730 - 37079674
Alignment:
| Q |
76 |
ctcacaattgtttcaacacttataatcacagcatcagtagcagcatgttttgctgtt |
132 |
Q |
| |
|
|||||| | |||||||| ||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
37079730 |
ctcacattggtttcaacccttataatcactgcttcagtagcagcatgttttgctgtt |
37079674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 79 - 132
Target Start/End: Complemental strand, 12493756 - 12493703
Alignment:
| Q |
79 |
acaattgtttcaacacttataatcacagcatcagtagcagcatgttttgctgtt |
132 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
12493756 |
acaattgtttcaacacttataatcactgcttcagtagcagcatgtttagctgtt |
12493703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University