View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-20 (Length: 130)
Name: Solexa-NF5839-20
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 46415135 - 46415257
Alignment:
| Q |
8 |
tgaaaacagttctgcacagaatctacgggaaattcatggttcataggccttttataaggaaatctgttagcaatatcatctaccggtttgtttttgagac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46415135 |
tgaaaacagttctgcacagaatctacgggaaattcatggttcataggccttttataaggaaatctgttagcaatatcatctaccggtttgtttttgagac |
46415234 |
T |
 |
| Q |
108 |
cgagcggcataatggaattgctg |
130 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46415235 |
cgagcggcataatggaattgctg |
46415257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University