View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-29 (Length: 121)
Name: Solexa-NF5839-29
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-29 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 1e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 61 - 121
Target Start/End: Complemental strand, 48277895 - 48277835
Alignment:
| Q |
61 |
ttttcttttctttggaaatttgattgaaggtgaaggatgattgatggattataaatcaaag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277895 |
ttttcttttctttggaaatttgattgaaggtgaaggatgattgatggattataaatcaaag |
48277835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 48278291 - 48278230
Alignment:
| Q |
8 |
gttctatctatataatttgaaaagaaaatctcaannnnnnnaattagttgtagttttctttt |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48278291 |
gttctatctatataatttgaaaagaaaatctcaatttttttaattagttgtagttttctttt |
48278230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University