View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-3 (Length: 230)
Name: Solexa-NF5839-3
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-3 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 8 - 230
Target Start/End: Original strand, 55002526 - 55002748
Alignment:
| Q |
8 |
taagctaccagtttttcaaatttacctgaagagtcttcaatcacaaattaaccatacaaactcataattaaagatcatgttttttcttttatgttcgacg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55002526 |
taagctaccagtttttcaaatttacctgaagagtcttcaatcacaaattaaccatacaaactcataattaaagatcatgttttttcttttatgttcgacg |
55002625 |
T |
|
| Q |
108 |
agcagggatgattttgcattttatgcggacctatgttttaaaacttttggtgatagagtaaagttctggatcacattcagcgaaccaaattacctagcat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
55002626 |
agcagggatgattttgcattttatgcggacctatgttttaaaacatttggtgatagagtaaagttctggatcacattcaacgaaccaaattacctagcat |
55002725 |
T |
|
| Q |
208 |
cactcggataccgttccggtctg |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
55002726 |
cactcggataccgttccggtctg |
55002748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 197
Target Start/End: Original strand, 54989105 - 54989193
Alignment:
| Q |
109 |
gcagggatgattttgcattttatgcggacctatgttttaaaacttttggtgatagagtaaagttctggatcacattcagcgaaccaaat |
197 |
Q |
| |
|
||||||| ||||||| ||| | || ||| ||||||||||| | |||||||| ||||| |||| ||||| |||||||| ||||||||| |
|
|
| T |
54989105 |
gcagggaagattttgtattattcgcagacatatgttttaaatcctttggtgacagagttaagtactggaccacattcaatgaaccaaat |
54989193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University