View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-30 (Length: 120)
Name: Solexa-NF5839-30
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-30 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 7e-53; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 6819461 - 6819573
Alignment:
| Q |
8 |
gaaccaccttattcctcctttattcaatctctcagtctagaccagtctcacattgattaccaccaccatcctcttcctcacccatcaccccttcctcctt |
107 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6819461 |
gaaccaccatattcctcctttcttcaatctctcagtctagaccagtctcacattgattaccaccaccatcctcttcctcacccatcaccccttcctcctt |
6819560 |
T |
|
| Q |
108 |
ttaaacaaccatc |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6819561 |
ttaaacaaccatc |
6819573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 8e-34
Query Start/End: Original strand, 28 - 120
Target Start/End: Original strand, 6819583 - 6819675
Alignment:
| Q |
28 |
tattcaatctctcagtctagaccagtctcacattgattaccaccaccatcctcttcctcacccatcaccccttcctccttttaaacaaccatc |
120 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||| |||||| |
|
|
| T |
6819583 |
tattcaatctctcagtctagaccactctcacattgattaccactaccatcctcttcctcatccatcaccccttcctccttttcaaccaccatc |
6819675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 28 - 96
Target Start/End: Original strand, 6819685 - 6819753
Alignment:
| Q |
28 |
tattcaatctctcagtctagaccagtctcacattgattaccaccaccatcctcttcctcacccatcacc |
96 |
Q |
| |
|
||||||||||||||||||| | || ||||||||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
6819685 |
tattcaatctctcagtctaaatcatcctcacattgattaccactaccatcctctcccacacccatcacc |
6819753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University