View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-31 (Length: 117)
Name: Solexa-NF5839-31
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-31 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 46921941 - 46921832
Alignment:
| Q |
8 |
agaagtaccctttggacgtaggattcaggcatgagagatctaagaacagagagatactcattcatttgctttctcctgttgcgttctacagcaatgtgag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46921941 |
agaagtaccctttggacgtaggattcaggcatgagagatctaagaacagagagatactcattcatttgctttctcctgttgcgttctacagcaatgtgag |
46921842 |
T |
|
| Q |
108 |
tcattctctg |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
46921841 |
tcattctctg |
46921832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 2e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 10 - 117
Target Start/End: Original strand, 36676386 - 36676493
Alignment:
| Q |
10 |
aagtaccctttggacgtaggattcaggcatgagagatctaagaacagagagatactcattcatttgctttctcctgttgcgttctacagcaatgtgagtc |
109 |
Q |
| |
|
|||||||||||||| || || || ||||| ||||| | ||||| ||| |||||||||||||| |||||||| || || || || ||||||||||||||| |
|
|
| T |
36676386 |
aagtaccctttggatgtgagaatctggcattagagagcgaagaatagaaagatactcattcatctgctttcttctattacgctcaacagcaatgtgagtc |
36676485 |
T |
|
| Q |
110 |
attctctg |
117 |
Q |
| |
|
|||||||| |
|
|
| T |
36676486 |
attctctg |
36676493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 114
Target Start/End: Original strand, 8873295 - 8873374
Alignment:
| Q |
35 |
ggcatgagagatctaagaacagagagatactcattcatttgctttctcctgttgcgttctacagcaatgtgagtcattct |
114 |
Q |
| |
|
||||||||||| ||||||||| ||||| ||||||||||| |||||| || ||||| ||||||||||| |||||||| |
|
|
| T |
8873295 |
ggcatgagagacctaagaacactgagatgatcattcatttggcgtctcctattacgttcaacagcaatgtgtgtcattct |
8873374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University