View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-5 (Length: 191)
Name: Solexa-NF5839-5
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-5 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 8 - 191
Target Start/End: Complemental strand, 14542706 - 14542523
Alignment:
| Q |
8 |
atgatgatgtttgaggttgaggaatggtagggatgagtgtgtggttgtatagtgcacaaagacaatttaaaatctactannnnnnnggactcaatttctg |
107 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14542706 |
atgatgatgtttgaggttgaggaatgtgagggatgagtgtgtggctttatagtgcacaaagacaatttaaaatctactatttttttggactcaatttctg |
14542607 |
T |
 |
| Q |
108 |
aaatctattagtaaaaatgtttatggtgttattttggtggctataagatatttgtccatttgcaagtggctggttacgtaccac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14542606 |
aaatctattagtaaaaatgtttatggtgttattttggtggctataagatatttgtccatttgcaagtggctggttacgtaccac |
14542523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 75
Target Start/End: Original strand, 14580887 - 14580952
Alignment:
| Q |
12 |
tgatgtttgaggttgagga-atggt-agggatgagtgtgtggttgtatagtgcacaaagacaattt |
75 |
Q |
| |
|
|||||||||||||||| || || || |||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
14580887 |
tgatgtttgaggttgaagatattgtgagggatgagtgtgtggttttatagtgcacaaggacaattt |
14580952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University