View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-6 (Length: 189)
Name: Solexa-NF5839-6
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-6 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 76 - 189
Target Start/End: Complemental strand, 31396450 - 31396338
Alignment:
| Q |
76 |
tacaattgatgtcgctcattgtaagtcgaaatttatagtattattcgttcttgcgattgaaaaaattatctaatatcttaattagagtcggttcgacaaa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31396450 |
tacaattgatgtcgctcattgtaagtcgaagtttatagtattattcgttcttgcgattgaaaaaattatctaatatc-taattagagtcggttcgacaaa |
31396352 |
T |
|
| Q |
176 |
aaataagaaaagta |
189 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31396351 |
aaataagaaaagta |
31396338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 31396610 - 31396530
Alignment:
| Q |
1 |
agacctagtatatgtcaaacctttggaagagatatacttgattggtcacatctagagtggatgtgtctcatatggtacaat |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31396610 |
agacctagtatatgtcaaacctttggaagagatatacttgattggtcacatctagagtggatgtgtctcatatggtacaat |
31396530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University