View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5839-8 (Length: 151)
Name: Solexa-NF5839-8
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5839-8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 5 - 151
Target Start/End: Original strand, 28078889 - 28079038
Alignment:
| Q |
5 |
acaatcatgattcttcatatttaaaccgcgtaatccactaactagaaagttcaattacatatacctagatttaaatgcaccatgaataagaa---aatta |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28078889 |
acaatcgtgattcttcatatttaaaccgcgtaatccactaactagaaagttcaattacatatacctagatttaaatgcaccatgaataagaaaataatta |
28078988 |
T |
 |
| Q |
102 |
gttcaaagctcatgtgtgttacatacagattaaatgatccgatcctcaga |
151 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
28078989 |
gttcaaagctcatatgtgtcacatacaggttaaacgatccgatcctcaga |
28079038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University