View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5840-10 (Length: 151)

Name: Solexa-NF5840-10
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5840-10
Solexa-NF5840-10
[»] chr3 (1 HSPs)
chr3 (5-151)||(30551934-30552080)
[»] chr4 (1 HSPs)
chr4 (57-115)||(26261347-26261405)
[»] chr6 (1 HSPs)
chr6 (56-115)||(9150030-9150089)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 5 - 151
Target Start/End: Original strand, 30551934 - 30552080
Alignment:
5 gagcaataaatattccctcttcaaatcattactaccgattaactcattcttagcatcaccggttgcctccatcaacacctcggatgtgttctactctgtt 104  Q
    |||||||||||||||||||||| |||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||    
30551934 gagcaataaatattccctcttctaatcattactaccgataaactcaatcttaacatcaccggttgcctccatcaacacctcggatgtgttctactctgtt 30552033  T
105 tctcttctctccattgatgttcttttatgatagtactactattgatg 151  Q
    ||||||||||||| || ||||||||||||||||||||||||||||||    
30552034 tctcttctctccaatggtgttcttttatgatagtactactattgatg 30552080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 26261347 - 26261405
Alignment:
57 gcatcaccggttgcctccatcaacacctcggatgtgttctactctgtttctcttctctc 115  Q
    ||||||| | ||||||||||||||||||| | |||||||| |||| |||||||||||||    
26261347 gcatcactgattgcctccatcaacacctccggtgtgttctgctctctttctcttctctc 26261405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 56 - 115
Target Start/End: Complemental strand, 9150089 - 9150030
Alignment:
56 agcatcaccggttgcctccatcaacacctcggatgtgttctactctgtttctcttctctc 115  Q
    |||||||| | ||||||||||||||||||| |  | |||| ||| |||||||||||||||    
9150089 agcatcactgattgcctccatcaacacctccggagagttccactatgtttctcttctctc 9150030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University