View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5840-10 (Length: 151)
Name: Solexa-NF5840-10
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5840-10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 5 - 151
Target Start/End: Original strand, 30551934 - 30552080
Alignment:
| Q |
5 |
gagcaataaatattccctcttcaaatcattactaccgattaactcattcttagcatcaccggttgcctccatcaacacctcggatgtgttctactctgtt |
104 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30551934 |
gagcaataaatattccctcttctaatcattactaccgataaactcaatcttaacatcaccggttgcctccatcaacacctcggatgtgttctactctgtt |
30552033 |
T |
|
| Q |
105 |
tctcttctctccattgatgttcttttatgatagtactactattgatg |
151 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
30552034 |
tctcttctctccaatggtgttcttttatgatagtactactattgatg |
30552080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 26261347 - 26261405
Alignment:
| Q |
57 |
gcatcaccggttgcctccatcaacacctcggatgtgttctactctgtttctcttctctc |
115 |
Q |
| |
|
||||||| | ||||||||||||||||||| | |||||||| |||| ||||||||||||| |
|
|
| T |
26261347 |
gcatcactgattgcctccatcaacacctccggtgtgttctgctctctttctcttctctc |
26261405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 56 - 115
Target Start/End: Complemental strand, 9150089 - 9150030
Alignment:
| Q |
56 |
agcatcaccggttgcctccatcaacacctcggatgtgttctactctgtttctcttctctc |
115 |
Q |
| |
|
|||||||| | ||||||||||||||||||| | | |||| ||| ||||||||||||||| |
|
|
| T |
9150089 |
agcatcactgattgcctccatcaacacctccggagagttccactatgtttctcttctctc |
9150030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University