View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5840-13 (Length: 146)
Name: Solexa-NF5840-13
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5840-13 |
 | |
|
| [»] chr5 (6 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 2e-59; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 11 - 146
Target Start/End: Original strand, 41522059 - 41522194
Alignment:
| Q |
11 |
gatgaagaactggcactggagatttcaatgtcgctcaaagaaaattttcttttaacggtgtcaactgcatttggaaatttgcttttttgttgtattgcca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
41522059 |
gatgaagaactggcactggagatttcaatgtcgctcaaagaaaattttcttttaaaagtgtcaactgcattgggaaatttgcttttttgttgtgttgcca |
41522158 |
T |
|
| Q |
111 |
cggatggacttggaacttcattcttcacagcaattc |
146 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41522159 |
cggatggacttggaacctcattcttcacagcaattc |
41522194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 41513124 - 41513256
Alignment:
| Q |
11 |
gatgaagaactggcactggagatttcaatgtcgctcaaagaaaattttcttttaacggtgtcaactgcatttggaaatttgcttttttgttgtattgcca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
41513124 |
gatgaagaactggcactggagatttcaatgtcgctcaaagaaaattttcttttaacagtgtcaactgcattgggaaatttgcttttttgttgtgttgcca |
41513223 |
T |
|
| Q |
111 |
cggatggacttggaacttcattcttcacagcaa |
143 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| |
|
|
| T |
41513224 |
cggatggacttggaacctcattcttcgcagcaa |
41513256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 27 - 102
Target Start/End: Original strand, 41506895 - 41506970
Alignment:
| Q |
27 |
tggagatttcaatgtcgctcaaagaaaattttcttttaacggtgtcaactgcatttggaaatttgcttttttgttg |
102 |
Q |
| |
|
||||| ||||| ||||||| ||||||||||||||||| || |||||||||||||||| ||| ||| |||||||||| |
|
|
| T |
41506895 |
tggaggtttcactgtcgctgaaagaaaattttcttttgaccgtgtcaactgcatttgcaaacttggttttttgttg |
41506970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 33 - 102
Target Start/End: Original strand, 41467404 - 41467473
Alignment:
| Q |
33 |
tttcaatgtcgctcaaagaaaattttcttttaacggtgtcaactgcatttggaaatttgcttttttgttg |
102 |
Q |
| |
|
||||| ||||||| ||||||||||||||||| || |||||||||||||| |||||||||||||||||| |
|
|
| T |
41467404 |
tttcactgtcgctgaaagaaaattttcttttgacagtgtcaactgcattgccaaatttgcttttttgttg |
41467473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 47 - 110
Target Start/End: Complemental strand, 41703723 - 41703660
Alignment:
| Q |
47 |
aaagaaaattttcttttaacggtgtcaactgcatttggaaatttgcttttttgttgtattgcca |
110 |
Q |
| |
|
|||||| |||||||||| || ||||||||||||| | ||||||||||| ||||||| |||||| |
|
|
| T |
41703723 |
aaagaagattttcttttgactctgtcaactgcattggaaaatttgctttcttgttgtgttgcca |
41703660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 41497646 - 41497702
Alignment:
| Q |
27 |
tggagatttcaatgtcgctcaaagaaaattttcttttaacggtgtcaactgcatttg |
83 |
Q |
| |
|
||||| ||||| ||||||| ||||||||||||||||| || |||| ||| ||||||| |
|
|
| T |
41497646 |
tggaggtttcactgtcgctgaaagaaaattttcttttgactgtgttaaccgcatttg |
41497702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University