View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5840-24 (Length: 130)
Name: Solexa-NF5840-24
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5840-24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 8 - 129
Target Start/End: Original strand, 28363444 - 28363565
Alignment:
| Q |
8 |
gattcattcttacgatccattactctgccatgttgttttaactatgtttttgcgttttattgatgcttttgatggtcaagaaggcgaggtttcgagtaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28363444 |
gattcattcttacgatccattactctgccatgttgttttagctatgtttttgcgttttattgatgcttttgatggtcaagaaggcgaggtttcgagtaga |
28363543 |
T |
 |
| Q |
108 |
ctgttgttgatttcgagagaag |
129 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28363544 |
ctgttgttgatttcgagagaag |
28363565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University