View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5840-26 (Length: 128)
Name: Solexa-NF5840-26
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5840-26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 30553406 - 30553325
Alignment:
| Q |
8 |
aattttcctaatcaatttttccaaattcttaaagttcatcctaaaagtcaatttctaaaacccggcaatcgattcttctaag |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30553406 |
aattttcctaatcaatttttccaaattcttaaagttcatcctaaaagtcaatttctaaaacccggcaatcgattcttctaag |
30553325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University