View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5840-31 (Length: 114)
Name: Solexa-NF5840-31
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5840-31 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 1e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 42122531 - 42122432
Alignment:
| Q |
7 |
acaaaatattgtaaaataactgttatagcagctatagcactgttgcgtaatgtgatttgaacaaaccgctatttttcgtgatacataattaacaacacta |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42122531 |
acaaaatattataaaataactgttatagcagct--------gttgcgtaatgtgatttgaacaaaccgctatttttcgtgatacataattaacaacacta |
42122440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 37 - 82
Target Start/End: Original strand, 36114312 - 36114357
Alignment:
| Q |
37 |
gctatagcactgttgcgtaatgtgatttgaacaaaccgctattttt |
82 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
36114312 |
gctatagcactgttgcgtaatgaaatttgaacaaacaactattttt |
36114357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 61 - 105
Target Start/End: Complemental strand, 1668378 - 1668334
Alignment:
| Q |
61 |
atttgaacaaaccgctatttttcgtgatacataattaacaacact |
105 |
Q |
| |
|
||||||||||||||||||||| |||||| || |||| |||||||| |
|
|
| T |
1668378 |
atttgaacaaaccgctattttccgtgattcacaattgacaacact |
1668334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 81
Target Start/End: Complemental strand, 30617256 - 30617212
Alignment:
| Q |
37 |
gctatagcactgttgcgtaatgtgatttgaacaaaccgctatttt |
81 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
30617256 |
gctatagcattgttgcgtagtggaatttgaacaaaccgctatttt |
30617212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 37 - 72
Target Start/End: Original strand, 7347767 - 7347802
Alignment:
| Q |
37 |
gctatagcactgttgcgtaatgtgatttgaacaaac |
72 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
7347767 |
gctatagtactgttgcgtaatgtaatttgaacaaac |
7347802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University