View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5840-7 (Length: 184)
Name: Solexa-NF5840-7
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5840-7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 7e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 7e-23
Query Start/End: Original strand, 71 - 129
Target Start/End: Complemental strand, 31849269 - 31849211
Alignment:
| Q |
71 |
catacaccaaccaccatttctgccgacacatcaacattaatacttgagtcacccacatc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31849269 |
catacaccaaccaccatttctgccgacacatcaacattaatacttgagtcactcacatc |
31849211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 167
Target Start/End: Complemental strand, 31849193 - 31849157
Alignment:
| Q |
131 |
actcatacactcatttttgcaaatacggttaattcaa |
167 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31849193 |
actcatacactcatttttgcaaatacagttaattcaa |
31849157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 7e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 7e-17
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 16806130 - 16806086
Alignment:
| Q |
21 |
gatcgagaacacttttgaaaattcagtgagattcttatgtattcc |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16806130 |
gatcgagaacacttttgaaaattcagtgagattcttatgtattcc |
16806086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University