View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5840-9 (Length: 160)
Name: Solexa-NF5840-9
Description: NF5840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5840-9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 8 - 118
Target Start/End: Original strand, 8568621 - 8568738
Alignment:
| Q |
8 |
catagacgctgctggattcaactctaaacacacgaaagatgcaccgcacacataactgccaatc-------aaattgaaattgaaattgcttagtagtaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8568621 |
catagacgctgctggcttcaactctaaacacacgaaagatgcaccgcacacataactgccaatcaaatttgaaattgaaattgaaattgcttagtagtaa |
8568720 |
T |
|
| Q |
101 |
taattactaattaattag |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8568721 |
taattactaattaattag |
8568738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University